Product Code Database
Amyloodinium ocellatum is a cosmopolitan ectoparasite dinoflagellate of numerous aquatic organisms living in brackish and seawater environments. It is the only species in the genus Amyloodinium. The dinoflagellate is Endemism in temperate and tropical areas, and is capable of successfully adapting to a variety of different environments and to a great number of hosts, having been identified in four phyla of aquatic organisms: Chordate, Arthropod, Mollusca and Flatworm. Moreover, it is the only dinoflagellate capable of infecting Teleost and Elasmobranchii .
The parasite represents a serious problem for both reared and aquarium fish, since amyloodiniosis, the infection caused by this protozoan, can lead the host to death in less than 12 hours, with acute morbidity and mortality around 100%. However, these two parameters vary considerably on the basis of farming typology, parasite burden, fish species and season considered. In general, amyloodiniosis is typically present in land- or lagoon-based rearing sites (valliculture or inland brackish farming), where shallow seabeds and poor water exchange/recirculation allow the parasite to reach its optimal proliferation values. Especially in the warmest months, A. ocellatum causes high mortality rates and economic damages.
The parasitic stage is represented by the sessile trophont. In this phase, the protist is pear-shaped, enclosed in a cellulose wall and exhibits specific structures, Rhizoid (tentacle like processes) that enable it to strictly anchor to host epithelia (gill or skin predominantly). If the infection is severe, trophonts can also be found on eyes, fins and in all oropharyngeal cavity, the latter is a typical infection site in the European seabass ( European bass). Constantly moving while anchored and therefore causing physical injuries to cells, trophonts inflict serious damages to the host, potentially inducing its death in 12-48 hours as a function of the parasite burden. Based on data in the literature, the trophont feeds directly from the host cells, probably using the stomopode by releasing digestive enzymes, which exacerbate the rhizoid lesions. Trophont size can vary considerably, with early trophonts measuring 27×23 μm while mature ones can reach up to 130×60 μm and more.
Two to six days after feeding, the trophont detaches from the host and encysts on inert substrates (pond/tank bottom or seabed) transforming into the tomont: the reproductive stage. In this phase, the protozoan is round and encapsulated in a cellulose wall, which becomes thicker and confers upon it an exceptional resistance to unfavourable conditions and to several therapeutic treatments. The protozoan reproduces asexually, the first division is longitudinal while the succeeding ones are approximately regular and at right angles to each other. Potentially, in two to four days, from a single tomont, 256 new dinospores can be generated. The number of newly formed dinospores is directly correlated to the nutritive state of the trophont.
The dinospore (8–13.5 × 10–12.5 μm), whose antero-posteriorly compressed shape resembles a hamburger, is the infective stage. In this phase, the armoured (cellulose wall) protist is capable of active swimming thanks to two flagella: one longitudinal, the other transverse. After adhesion to a new host, the dinospore transforms into a trophont within 5 to 20 minutes.
Usually host behavioural changes are the first amyloodiniosis symptoms, represented by jerky movements (flashing), pruritus and dyspnoea with gathering at the water surface. Lethargy and anorexia appear in the advanced stages of the infection. Another clinical sign of amyloodiniosis could be the dusty appearance of the skin (hence the name "marine velvet disease"), as in European bass, but not in all fish species.
Molecular identification can be applied as a second, confirmatory, diagnostic step in addition to clinical and microscopic identification. Recently developed molecular approaches (PCR and LAMP) have been proven to provide early detection of dinoflagellates in water and gill tissue samples, even when the parasite is present at lowest concentrations, such as in subclinical infections. Therefore, these methods potentially allow for highly sensitive monitoring of pathogen load in susceptible fish populations. Molecular diagnosis of A. ocellatum is based on primers AO18SF (5' GACCTTGCCCGAGAGGG 3') and AO18SR (5' GGTGTTAAGATTCACCACACTTTCC 3') for PCR amplification of a 248 bp segment of the 3' end of the LSU rDNA gene. Multiple sequence alignment using the Clustal confirmed that sequenced AO was conserved with different geographic isolates from Mediterranean Sea (DQ490256.1), Red sea (DQ490257.1), Fujian-China (KU761581.1 and KR057921.1), Southern Mississippi-USA (JX905204.1). However, these techniques are still limited to laboratory contexts.
In parallel, immunological approaches such as ELISA (enzyme linked immunosorbent assay) can detect the specific anti- A. ocellatum antibody levels in fish recovering from amyloodiniosis outbreaks or that have been experimentally exposed to the parasite. The ELISA assay might be useful for monitoring levels of protection in susceptible populations, as elevated antibody titres have been associated with resistance.
Copper sulphate is one of the most effective treatments to control A. ocellatum epidemics in aquaculture, due to the proven dinosporicide properties of the free copper ion, but also because it is inexpensive and easy to find. The infusion of copper sulphate at 0.75-1 g/m3 for almost two weeks by dripping on ponds/tanks, maintaining constant copper concentration, is very effective to kill dinospores, while tomonts and trophonts are not very susceptible. Currently, copper sulphate is not approved by the European Regulation n. 1907/2006 (REACH) as amyloodiniosis treatment, despite its approval as an effective algaecide.
Freshwater baths are an effective way to detach trophonts from skin and gill epithelium due to the sudden osmotic shock experienced by the host. However, freshwater bath procedures remain impractical for the majority of marine fish farms and some fish species cannot tolerate a similar treatment.
Another aspect that can be taken into account is the choice of an appropriate rearing site. Parasitosis can be influenced by its characteristics. Normally, sea cage reared fish are not affected by the infection, while it is more difficult to control the infection in valliculture or inland brackish farming systems.
Prevention of the disease by vaccination is not possible, although some studies are in progress to identify potential vaccine candidate proteins, i.e. i-antigens, of the parasite. Fish that survive amyloodiniosis may develop at least a partial immunity.
|
|
